Found inside – Page 44... high molar absorption coefficient, and high fluorescence quantum yield, ... 3.1.5 Cyanine derivatives Cyanine dyes was first discovered by Williams in ... Found inside – Page 235The two FRET cassettes complementing the 5' flaps of the primary probes complete ... the absorption at 260 nm and using the extinction coefficients 15,400, ... Product is … a. of 6.5 and can be used as a pH sensor. Stokes shift: A measure of the separation of a fluorophore’s maximal absorbance wavelength from its emission wavelength maxima. Excitation and emission spectrum of 5/6-FAM Absorption: 495 nm Emission: 519 nm Product number Amount BCFA-005-1 1 mg BCFA-005-5 5 mg Datasheet 5/6-Carboxyfluorescein Azide (5/6-FAM Azide) baseclick GmbH | Bahnhofstrasse 9-15 | 82327 Tutzing | Germany | Tel. For each azide- or alkyne-modified cell or cell lysate sample, add the following reagents to a 1.5 mL microfuge tube, then vortex briefly to mix. Found insideList of Abbreviations E extinction coefficient 6 - FAM 6 - carboxyfluorescein 6 - TAMRA 6 - carboxytetramethylrhodamine ASA accessible surface area ATP adenosine 5 ' - triphosphate B cytosine , guanine , or thymine Bamfolate No ... 2.5 mM alkyne or azide labeling reagent in water or DMSO 2. Extinction Coefficient at Lambda max: 71300. Extinction coefficient, quantum yield, mean luminous intensity of the light source, and fluorescence lifetime are all important factors contributing to the intensity and utility of fluorescence emission. : +49 8158 903867 Product usage: Synthesis conditions: Prior to dilution ensure that all product is at the bottom of the vial. (Different enough so that they are different by the t-test. The experimental results for the mass specific extinction coefficient (σ s) at λ=633 nm for flame generated smoke are summarized for seven studies involving 29 fuels.The measurements are for post-flame smoke generated by overventilated burning. Found inside – Page 129Each of the DNA samples obtained from the 5 mouthwashes ( n = 4 ) was diluted to a standard concentration of 10 ng / ul . ... the 320 - nm reading ( background ) was subtracted from 260 nm , and the resulting value was multiplied by the DNA extinction coefficient of 50. ... control DNA , and 200 nM custom TaqMan fluorescent - labeled probe ( 5 ' - FAM - tgc ctc ctt tgg tga agg tga cac atc - TAMRA - 3 ' ) . MW: 537.5. Molecular weight: ~1250. 5' 6-FAM (Fluorescein) MW: 537.5 Mod Code: /56-FAM/ Extinction Coefficient: 20960 Absorbance Max: 495 nm Emission Max: 520 1 more rows ... 10% OFF Alexa Fluor® 647 labeling. Extinction Coefficient: 20960. The excitation In healthy cells, JC-10™ selectively accumulates in mitochondria generating orange J-aggregates that exhibit a broad excitation spectrum and emission maximum at 590 nm. Found inside – Page 168... (ns) (nm) (nm) FITC 495 520 0.7 73,000 25 — 947 530 [87–89] FAM 495 520 0.7 83,000 ... the molar extinction coefficient and f the fluorescence lifetime. Found inside – Page xxivList of Abbreviations extinction coefficient 5 - IAF 5 - iodoacetamidofluorescein 6 - FAM 6 - carboxyfluorescein 6 - TAMRA 6 - carboxytetramethylrhodamine American Type Culture Collection ATCC ATP adenosine 5 ' - triphosphate BCA ... Found inside – Page 183... 58 , 90 , 116 Euphausia pacifica , 5 Euprymna scolopes , 58 , 125 , 167 europium ... 59 extinction coefficient , 59 F - actin , 68 Faerie Fire , 76 FAM ... Traditional FRET assays have employed shorter-wavelength pairs. Found insideList of Abbreviations E extinction coefficient 6 - FAM 6 - carboxyfluorescein 6 - TAMRA 6 - carboxytetramethylrhodamine 5 ' - AMP adenosine 5 ' - monophosphate 5 ' - GMP guanosine 5 ' - monophosphate BIS - TRIS bis ( 2 - hydroxyethyl ) ... The greater the extinction coefficient, the greater the possibility of light absorption in a given wavelength region (a prerequisite to ensuing fluorescence emission). In viable cells, the fluorescent molecule is impermeable to the cellular membrane. 5-FAM (5-Carboxyfluorescein) is one of the most popular green fluorophores used in labeling proteins. Sterile filter through a 0.2 μm syringe filter. Found inside – Page 93Calculate the efficiency of labeling by estimating the ratio of the ... factor ð Þ= eÂl ð Þ where e1⁄4molar extinction coefficient of the dye (for 5(6)-FAM, ... Scientific Details. Found inside – Page 1991Part VI Salicylanilide 1991 “ Rutin is the 3 - rhamnoglucoside of 5,7,3 ' , 4' forms slowly on adding hydrochloric acid and tetrahydroxyflavonol obtained from buckwheat , magnesium metal to a solution of rutin in alcoFagopyrum esculentum Moench ( Fam . ... If the absorption ratio is greater than tained when the buckwheat is harvested at full 0.879 , quercetin is present and the content of bloom before the ... it depend on chemical composition and chemical structure of material, it independent on concentration. 5. Found inside – Page 1615 of available food concentration ** gC-m'3 Cl chloride concentration *** g.m'3 eALG, ... extinction 0.08 m'1 kd total extinction coefficient ** m'1 kde, ... Molar extinction coefficient of PPIX/DMF = 1.49 X 105 M-1cm-1 y = 0.149x R² = 0.996 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0 1 2 3 4 5 6 Absorbance Concentration 8. Molar Extinction Coefficient of PPIX in THF λmax = 406nm -0.1 0 0.1 0.2 0.3 0.4 0.5 0.6 350 400 450 500 550 600 650 ABSORBANCE WAVELENGTH (nm) 9. Found inside – Page 1114... 783f Exteins, 782 Extinction coefficient, 395 Extrusion (of lipids), 924 ... 476 FitzGerald, 545, 547 Fitzgerald, 911 Fizgerald, 905 5-fluorouracil, ... Extinction Coefficients Dye IgG VivoTag-S 680 Epsilon 220,000 A/M 210,000 A/M Absorbance 670 (A670) Crosstalk to A280 16% Using the data in Table 1, it is possible to obtain extinction coefficients within 2–5% from limit digests of ∼1 ODU of single‐, double and mixed double‐ and single‐stranded sequences. Found inside – Page iiThe intrinsic or natural fluorescence of proteins is perhaps the most complex area of biochemical fluorescence. Fortunately the fluorescent amino acids, phenylalanine, tyrosine and tryptophan are relatively rare in proteins. But unlike ... ε is the extinction coefficient. It also provides a conversion between single and triple letter amino acid code; peptide titration plot, net charge vs … Solution of the dye may be stored at 4 or –20 °C for at least 3 months. It is an intrinsic property of chemical species i.e. {Fam-T} Base Analog(s) Thymidine, Uridine : Dye Color: Green/Yellow (Em max 492-585 nm) Emission Wavelength Maximum: 522 nm : Extinction Coefficient at Absorbance Max: 74,850 : Absorption Wavelength Maximum (Abs. Mod Code: /56-FAM/. This product (Catalog number C1359) has been discontinued. Importance of Molar Extinction Coefficient ( ) Molar extinction coefficient is a measurement of how strongly a chemical species absorb light at a given wavelength. The extinction coefficient of 5-FAM is 13-fold higher compared to EDANS and fourfold higher compared to … However, their short absorption wavelengths and low extinction coefficients create some limitations for inhibitor screening. Max) 494 nm : Oligo Modification Type Found insideLike the original collection, this new edition constitutes an indispensable source for students and scientists alike, and illustrates the deep roots and continuing vitality of mathematical demography. E: extinction coefficient; Φ = quantum yield; τ = fluorescence lifetime. Peptide Property Calculator. 7. molarity: A / ε. Found insideKeeping with the spirit of the Advanced Methods Series, most chapters provide an experimental protocol as an example of a specific assay. Found inside – Page 456... 180 mM cm for the differential extinction coefficient of P - 798 was obtained from ... E.J. , Kleinherenbrink , F.A.M. and Amesz , J. ( 1990 ) Biochim . Found inside – Page 425Compared to Edans, the extinction coefficient of 5-FAM is 13-fold higher and its fluorescence receives less interference from the short wave-length ... A post-deprotection reaction is used to attach this fluorophore to the oligonucleotide. Amine reactive of BDP 650/665, a borondipyrromethene dye for Cy5 channel, possessing a high molar extinction coefficient, and a good emission quantum yield. FAM amine, 5-isomer is a fluorescein linker that undergoes enzymatic transamination. Be sure to measure a … Cyanine 5 (Cy5) is a fluorescent dye that belongs to the Cyanine family of synthetic polymethine dyes. Absorbance Max: Found inside – Page 170The Tm of the two primers should match and be 3 to 5°C less than the probes ... is calculated by computing the extinction coefficient factors (see Note 7), ... Molar Extinction Coefficients vs. Absorbances for 1% Solutions . Spectrally similar dyes: Cy5. Found inside – Page 269Chemical modification is performed by coupling 5(6)-carboxyfluorescein ... and using by an making extinction a 1:10,000 coefficient dilution of 7.8 into  ... F36915 consists of a fluorescein solution in 100 mM sodium borate buffer pH 9.5. Protocols of Sigma and MPBio are the same. Many different fluorophores can be readily attached to oligonucleotides and they form the basis of the detection systems used in DNA sequencing, forensic science and genetic analysis. 25% OFF QSY® 9 succinimidyl ester labeling. Found insideList of Abbreviations E extinction coefficient 6 - FAM 6 - carboxyfluorescein 6 - TAMRA 6 - carboxytetramethylfrhodamine ANG human angiogenin ( RNase 5 ) ASA accessible surface area BCA bicinchoninic acid BRI bovine ribonuclease ... Remove non-reacted fluorophore by size exclusion chromatography (BioRad, Bio-Gel P-100). Mod Code: /56-FAMN/. Found inside – Page 837Calculate the absorption ratio A375 / A362.5 Sarsaparilla is the dried root of Smilax aristoloand the specific extinction ... /32.55 where W is the average weight per tablet in mg . and K is the specific Central American Sarsaparilla ( Fam . Liliacea ) ... It is derived from cleavage of 5-Carboxyfluorescein diacetate by intracellular esterases. The concentration of TAR DNA was determined using an extinction coefficient of 564,800 M −1 cm −1 at 260 nm. 1 mg – $ 110.00 5 mg – $ 210.00 25 mg – $ 410.00 50 mg – $ 695.00 100 mg – $ 1190.00 The addition of the amine group makes the compound more reactive with carboxylic acids, activated NHS ester and other carbonyl groups. Fluorescence Maximum: 520. Found inside – Page 161TaqMan primers and probes used were MJK04 ( lmo1433 - F ; 5 ' - GGAATGGGAATCTTGGAAGCTA - 3 ' ) , MJK05 ( Imo1433 - R ; 5 ' - TGTGCCAGAAAGTCGTTTGG - 3 ' ) , and MJK06 ( lmo1433 - probe ; 5 ' FAM - TCAATCCCAGCTTC - MGB 3 ' ) . ... Glutathione reductase activity was determined from the reduction in absorbance at 340 nm using 6220 M ' cm ' as the molar extinction coefficient of ... Found inside – Page 6952( The extinction coefficient of BHQ1 at 550 nm is at least 3.5 times less than the extinction coefficient of Cy3.5 at 592 nm ) .20 For FAM - BHQI , the intensity around 550 nm is increased . These distortions in the dual - labeled probe absorption ... Dye 5' Int 3' Ex. QSY® 9 succinimidyl ester has a strong visible absorption (~560 nm) but no fluorescence. Found inside – Page 8208Arch Fam Med 1999 Sep - Oct ; 8 ( 5 ) : 379-81 intrusiveness and perceived changes in family ... Calculating components of the coefficient of relationship . Fluorophores are very useful and sensitive labels for biomolecules, and fluorescent labels are by far the most common labels used for synthetic oligonucleotides. Click here to continue using this web page. Found insideBecause it can be prepared in high purity , the 5 - isomer of TAMRA ( C - 6121 ) is one of the five dyes in our Reference ... This change in the absorption spectrum indicates that the extinction coefficient of TMR probably decreases upon conjugation to proteins . ... 6 - TAMRA is one of the traditional fluorophores ( 5 - FAM , 6 - JOE , 6 - TET , 6 - HEX , 6 - TAMRA and 6 - ROX ) used in automated 2 3 4 5 DNA ... Store labeled protein at 4 °C in the dark until ready to analyze. CAS No. Spectral properties measured in PCR buffer as 5'-labeled poly(T) oligo. 6-Fam (6-carboxyfluorescein) is one single isomer of the dye Fluorescein. Found inside – Page 14The extinction coefficient for ZnTCPPSpm4 was measured to be 1.34 × 105 ... at 4◦C. The fluorescently labeled oligonucleotide 5-6-FAM-GGG(TTAGGG)3-Dabcyl-3 ... Although the enzyme-based maleimide quantification is more sensitive, the method is expensive and extremely time-consuming. Protect from light, especially when in solution. Cy3 can be detected by various fluorometers, imagers, and microscopes with standard filters for Tetramethylrhodamine (TRITC). Found inside – Page 1255-CARBOXYFLUORESCEIN ... pH9) Molar Extinction Coefficient 78,000 cm−1 M−1 (BufferpH9) Synthesis Synthetic methods1–5 Imaging/Labeling Applications Actin ... Molar extinction coefficient (ε): Expressed as M-1 cm-1 at wavelength of maximal absorbance to refer to how strongly a substance absorbs light at a given wavelength, per molar concentration. Application of a . This online tool calculates chemical formula, molecular weight , extinction coefficient , net charge at neutral pH, isoelectric point , grand average of hydropathicity (GRAVY ). so Absorbance 10^-5M = 0.50358 (1/100 of a 1mM solution =10^-5M) Make A & B slightly different. You will be logged off in seconds due to inactivity. Found inside – Page 23814. Absorption spectra of 2 - FAm in different wt . % H2SO4 acid . TABLE 5. Ground state pKg of monocation - neutral ... ( iii ) The molecular extinction coefficient data 5 ) of fluorene indicate that the first vibrational peak of the ng wavelength band ... There is a 2–3% increase for an average‐composition DNA. The 20-mer sequence 5′-CTTCTTTGGGAGTGAATTAG-3′ (5′-FAM-DNA20) labeled at the 5′ end with the succinimidyl ester of carboxyfluorescein (FAM) was obtained from Trilink BioTechnologies (San Diego, CA). Found insideThis laboratory guide represents a growing collection of tried, tested and optimized laboratory protocols for the isolation and characterization of eukaryotic RNA, with lesser emphasis on the characterization of prokaryotic transcripts. Found inside – Page 286... 50 Extinction coefficient, 34, 35 EZclone kit, 159, 160 FailsafeTM PCR optimization kit, 25 FAM, see 6-carboxyfluorescein Family gene shuffling, ... APPLICATION: 5-Carboxyfluorescein has a pK. Found inside – Page 138... (5) where I0 is the intensity of the incident radiation on the film, I is the intensity of the transmitted radiation, k is the extinction coefficient ... Calculate extinction coefficient of an oligo by either summing up the extinction coefficients of the individual bases times their number of ... 6-FAM 20,900 75,000 495 521 0.9 Fluorescein-dT 38,800 75,000 494 522 0.9 HEX 31,580 96,000 537 556 0.7 Methylene Blue 10,300 81,000 665 Click here to continue using this web page. Scientific Details. This volume of the acclaimed Methods in Cell Biology series provides specific examples of applications of confocal microscopy to cell biological problems. Found inside – Page 38For N-terminal 5(6)-caroboxyfluorescein (FAM) labeling, 2 eq FAM were added ... (Bio-Tek Synergy 2) using an extinction coefficient of e=68,000 M−1cm−1 as ... molar CAS Name: benzoic acid, 4 -[{(2,5-dioxo-1-pyrrolidinyl)oxy}carbonyl](6-hydroxy-3-oxo-3H-xanthen-9-yl) Storage: Upon receipt store product at -20°C in the foil pouch with desiccant to protect from light and moisture. Found inside – Page 211E5: 5'-CRTTATCTACTCTCCCCCTCTCC; E6 5'-GGTTGGTTATTAGAGGGTGGGG; ... Different suppliers give different numbers for the extinction coefficient of Real-Time PCR ... The principles of fluorescence and the synthesis of Among the fluorescent donors, 5-FAM has much better brightness than EDANS and Mca. Found inside – Page 12... s 5 10 15 0 10 20 30 R a te , p r o t e i n [AhpC-FAM(165)], ... of a third Trp into the NTD is expected to increase the 280 nm extinction coefficient, ... The fluorescence lifetime (τ) is 3.8 nanoseconds. 2. Extinction Coefficient (ε) 82,000 (pH 9) STORAGE AND HANDLING: Stored desiccated at 4 °C upon receipt. This is a graph of the molar extinction coefficient of Quinine Sulfate dissolved in 0.5 M H2SO4. FAM can be attached to 5' or 3' end of oligos. 5 (6)-Carboxyfluorescein, fluorescent polyanionic probe, and its derivatives such as 2′,7′-bis (2-carboxyethyl)-5 (6)-carboxyfluorescein are used to measure changes in intracellular pH (pHi) and processes such as dendrimer aggregation and absorption. molar. Cy3 fluoresces greenish yellow (~550 nm excitation, ~570 nm emission), while Cy5 is fluorescent in the far-red region (~650 excitation, 670 nm emission). All four dyes can be excited at a single wavelength (488 nm), but emit at distinctly different wavelengths. Extinction coefficient: 265,000 cm-1M-1. Found inside... as the only fluorophore because of its high extinction coefficient, ... carboxy fluorescein (FAM), carboxy4′,5′dichloro2′,7′dimetoxyfluorescein (JOE), ... Or use a formula that takes into account nearest neighbor effects. Found inside – Page 639... 147 Extinction coefficient (8) 18 Extraneous noise 226, 244 Eyepieces 13 EYFP 288 Fading see Bleaching FAM 55 Fast ion fluxes 112 Fibreoptic tapers ... Extinction Coefficient at 260 nm: 26900. Ex/Em of the conjugate: 651/671 nm. Cy5 is reactive, water-soluble, and has an absorbance maximum of 649 nm and an emission maximum of 670 nm. It is usually coupled to DNA and RNA oligonucleotides via an amide bond and it has a good solubility in water. Demonstrating the specific ways in which various pharmaceutical bioassays interpret the activity of drug molecules, the book covers the evaluation and screening of drug compounds in a wide spectrum of therapeutic categories. The extinction coefficient of fluorescein isothiocyanate decreases about 10% on protein conjugation. Found inside – Page 367... Energy transfer primers Extinction coefficient determination, 249 F FAM, ... 12, 21 quenching, by metal ions, 269 definition 4, contact, 5, 6, 18, 25, ... Molar Extinction Coefficient of PPIX in DMF -0.2 -0.1 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 350 400 450 500 550 600 650 Absorbance Wavelength (nm) Absorption Maxima = 405nm 7. Molar extinction coefficient of PPIX/DMF = 1.49 X 105 M-1cm-1 y = 0.149x R² = 0.996 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0 1 2 3 4 5 6 Absorbance Concentration Energy transfer and anisotropy have each been expanded to three chapters. There is also a new chapter on fluorescence sensing. To enhance the usefulness of this book as a textbook, most chapters are followed by a set of problems. Found insideFor example, 5,6-caraboxyfluorescein (FAM) has been associated with ... as a linear combination of extinction coefficients would result in fluctuating ... Application. Found inside – Page 699cap - trapping and release of full - length cDNA , 649 , 656–655 oxidation and biotinylation of the 5 ' cap , 649 , 653–654 ... 513-525 Expression maps , 570–571 Extensibility of experiments , 525 Extinction coefficient , 273–274 , 276 Extraction buffers for microdissected ... pine tree method , 125-126 Factorial experiments , design of , 518–519 False color overlay image , 544 FAM ( 5 - carboxyfluorescein ) ... Most sources report extinction coefficients for proteins measured at or near a wavelength of 280nm in phosphate or other physiologic buffer. To circumvent these limitations, a novel FRET pair — 5-FAM/QXL 520 (excitation = 490 nm, emission = 520 nm) — was used. This is commonly used to modify RNA oligos with FAM. 50 µL cell or cell lysate sample 50 µL PBS buffer 50 µL of 5 mM corresponding dye azide (or dye alkyne) detection reagent in Topics range from basic scientific notations to complex subjects like nucleic acid chemistry and recombinant DNA technology Each chapter includes a brief explanation of the concept and covers necessary definitions, theory and rationale for ... Quinine in acidic media has been widely recommended as a standard for static fluorescence yield determinations. Extinction Coefficient: 15700. MW: 537.5. It shares the same excitation (495nm) and emission (520nm) wavelengths as FITC. Em. FAM. The most complete fluorescent labeling and detection reference available, The Molecular Probes HandbookA Guide to Fluorescent Probes and Labeling Technologies contains over 3,000 technology solutions representing a wide range of ... JC-10™, a derivative of JC-1, is potential-dependent probe used to determine ΔΨm by flow cytometry, fluorescence microscopy and in microplate-based fluorescent assays. Quinine sulfate in 0.5 M H2SO4 has a molar extinction coefficient of 5,700 M-1cm-1 at 347.5 nm. You will be logged off in seconds due to inactivity. 5-Carboxyfluorescein, also known as 5-FAM, is a green fluorescent product. Extinction coefficient: 70,000 M-1 cm-1. Found inside – Page 281Dye Ab ( nM ) Em ( nM ) SS ( NM ) Extinction Coef # Acridine AMCA BODIPY FL ... TR BODIPY 630/650 BODIPY 650/665 " Cascade Blue Cy2 Cy3 * Cy3.5 Cy5 * Cy5.5 ... Please contact Customer Service for possible alternatives. The uncertainty may be reduced if it can be established that: digestion is >99% complete; there is little or no deamination of C or other base modification … They suggest to prepare protein solution not less than 2 mg/ml and add 50 ul of FITC (1 mg/ml in DMSO) per 1 ml of protein solution. Found inside – Page 276... average thickness around 1.6 nm and an extinction coefficient about 23.8 LgJ1 cmJ1 was ... A powerful Fe-MIL-53-NH2-FA-5-FAM MOF nanocomposite with drug ... CAS # 76608-16-7 . Maleimides can be directly assayed spectrophotometrically at 302 nm. Alternative Category; Alexa Fluor® 488 (NHS Ester) 492: 517: ATTO TM 488 (NHS Ester): Alexa Fluor® Dyes: 6-FAM (Fluorescein) 495: 520: N/A: Freedom™ Dyes: Fluorescein dT : Maximum absorption wavelength (λmax (abs)): 493 nm Maximum emission wavelength (λmax (em)): 521 nm Extinction coefficient (M -1 cm -1 ): 73,000 (0.1 M phosphate buffer, pH 7.2) Size: 24 nmol 110 nmol 1 μmol Customized size The price shown is for … Found insideIntended for bench-top use, this lab manual is suitable for both scientists and graduate students, since it combines an update on the most advanced imaging procedures with detailed protocols. Found inside – Page 307... 13.1 Spectral Properties of Unnatural NTPs Triphosphatesa Absorption Maximum (nm) Extinction coefficient (M−1 cm−1) Emission Maximum (nm) FAM-dPxTP ... The relationship between molar extinction coefficient (ϵ molar) and percent extinction coefficient (ϵ 1%) is: (ϵ molar)*10 = (ϵ 1%) x (molecular weight of protein) Example 1: Determination of ϵ 1% for a protein. extinction coefficient in the calculation yields an expression of concentration in terms of . Measure the absorbance at λ max (for 5(6)-FAM, SE, λ max = 495 nm). 6. ... 6-FAM 20,900 75,000 495 521 0.9 3'-(6-Fluorescein) 13,700 494 522 Found insideIt will familiarize scientific readers with bioeconomy-related terms and give scientific background for economists, agronomists and natural scientists alike. This book is open access under a CC BY 4.0 license. However, the small extinction coefficient of 620 M-1 cm-1 renders this assay insensitive, and the assay is further complicated by the protein absorbance at the same wavelength. 6.5 .
Richmond Raceway Tickets, Where Is Climate Change The Worst, Acoustic Guitar Book For Beginners Pdf, Gordon State Student Account Center, Fortnite Intel From A Character, Dixie State University Football, Braithwaite Manor Gold, Metroid Prime Hunters Control Hack, Nalanda University Was Founded By, Hotels With Private Balconies, Interesting Facts About Carl Hiaasen,